Sevpolitforum.info

Севастопольский Политфорум
Текущее время: 26 ноя, 2020, 1:17

Часовой пояс: UTC + 3 часа



Начать новую тему Ответить на тему  [ Сообщений: 34150 ]  На страницу Пред.  1 ... 1352, 1353, 1354, 1355, 1356, 1357, 1358 ... 1366  След.
Автор Сообщение
СообщениеДобавлено: 23 ноя, 2020, 0:06
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
12k сообщений+
Аватара пользователя

Зарегистрирован: 04 май, 2008, 10:28
Сообщения: 12173
Откуда: Россия, Электросталь
Warnings: 1
Баллов: 2566

Добавить баллУбрать балл
escarcha писал(а):
подойдёшь ко мне без маски - получишь в хлебало. Непринуждённо.

Вспомнилось чьё-то известное высказывание:

Цитата:
Если ко мне придет вегетарианец и скажет, что не ест мяса - я приготовлю ему вегетарианскую котлету.
Если ко мне придет вегетарианец и скажет, что я должен не есть мясо - я сделаю котлету из вегетарианца.

А здесь - не тот случАй. Никто ковид-диссиденту не окажет почести в виде неношения маски из уважения к его взбалмошным взглядам - может выйти себе дороже.
А за откровенные требования ко всем не носить маску - ст. 270.1 и 270.2 УК РФ никто не отменял.

И перепосты говнороликов и ссылок на них тоже попадают под другую статью - распространение заведомо недостоверной общественно значимой информации под видом достоверных сообщений, наказуемое по части 9 статьи 13.15 КоАП РФ (злоупотребление свободой массовой информации).

За совершение данного правонарушения предусмотрено наказание в виде административного штрафа на граждан в размере от 30 тысяч до 100 тысяч рублей с конфискацией предмета административного правонарушения или без таковой.

Так шта, кукуся Иценков, суши сухари. Попандопуло хренов :mrgreen:

Изображение Изображение
Коронавирус показал, кто у нас на самом деле болен


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 0:16
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
12k сообщений+

Зарегистрирован: 28 мар, 2014, 21:07
Сообщения: 21361
Баллов: 2118

Добавить баллУбрать балл
Лещенко, ...удак старый, не только не носил маску и не стал соблюдать самоизоляцию по возвращению из-за бугра, но еще и завалился на вечеринку, уже чувствуя себя плохо. То есть подверг опасности жизнь кучи... таких же избалованных кретинов, как и он сам...
И что? Посадили, наказали, оштрафовали? Да хрен там. А это был всего лишь первый громкий случай. Потом было шоу Малахова, областной министр здравоохранения, главный областной эпидемиолог и т.п.
А потом был Письков с его вечеринкой в честь дня рождения жены. разумеется без масок. Отличный пример для подражания.
Бесполезно увещевать и пугать законами, которые не применяются или применяются очень-очень избирательно.

Я всегда думал что демократия - это власть народа, но вот товарищ Рузвельт объяснил, что демократия - это власть американского народа. /И.В.Сталин.

Апофеоз каклизма в России: "Вот мы и имеем границы. Какие уж получились." (с) ValeriyV


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 0:44
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
12k сообщений+
Аватара пользователя

Зарегистрирован: 04 май, 2008, 10:28
Сообщения: 12173
Откуда: Россия, Электросталь
Warnings: 1
Баллов: 2566

Добавить баллУбрать балл
AlexMoscow писал(а):
Бесполезно увещевать и пугать законами, которые не применяются или применяются очень-очень избирательно.


уёша
Ты забыл главное: рассказать, какие именно законы нарушили упомянутые тобой персонажи, причём не на твой взгляд, а с точки зрения суда.

Да и на твой взгляд - валяй! Номера статей и названия кодексов я привёл.

Напомню, как ты жидко обгадился со своим "бесконечным списком воров" :mrgreen:

Не докажешь - получишь звание 16-кратного Изображение

Изображение Изображение
Коронавирус показал, кто у нас на самом деле болен


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 0:59
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
*******
Аватара пользователя

Зарегистрирован: 14 янв, 2015, 15:38
Сообщения: 3461
Баллов: 1170

Добавить баллУбрать балл
из Калининграда писал(а):
VIST57 писал(а):
cut писал(а):
Как здравомыслящий человек, я понимаю, что моя маска сможет уберечь другого человека от заболевания

Здравомыслящий человек, даже ребенок, понимает, что тряпочка это не диод (это когда в одну сторону дуй, а в другую ничего) она в обе стороны работает одинаково.
И если она может уберечь другого человека, то точно также может уберечь и тебя.
Но не уберегает. Она сама это признает. Тогда что?
Если бы эту курицу заставить в маске грузить уголь, то до нее бы дошло, на практике, что эта маска не уберегает даже от крупной пыли.
Кто-то придумал эту глупость, про «уберегание» окружающих не основанную ни на чем, но дающею возможность давить на порядочность. И куча людей без мозга повторят это, как попугаи.
Вспомнилось Задорновское «ну тупые...». Было смешно. Они были далеко. Не думал, что доживу, до того времени, когда они будут рядом. Что они будут, был уверен. «Их производством» уже давно занимаются в мировом масштабе. Но что бы так быстро...

Гы! Вы видать ни угольной пыли, ни CS не нюхали. Маска не даёт 100% гарантии. Но уменьшает вероятность. Разумеется одинаково в обе стороны. Мешает выделять брызги слюней и соплей изнутри и ловить чужие снаружи. Не диод, разумеется - хотя бы сопротивление.

Приходилось. Всяко-разно… Я ведь не просто конструктор, а еще через тире — технолог.
Поэтому литейка, молярка, гальваника, кузня… И отлично знаю чем там надо защищаться.
С маской вас там на смех подняли бы. Хотя там и пыль и аэрозоли покрупнее будут, на несколько порядков.
Но прогресс уже есть. Значит сопротивление, говорите. Хорошо.
Тогда заканчивайте нести дичь про то, что надо носить маску исключительно, чтобы защитить окружающих.

А теперь дальше. Вероятность снижается, говорите… Посчитать это нельзя, ставить эксперимент, бесчеловечно. (Чтобы получить более-менее достоверную вероятность надо несколько тысяч испытуемых)
Поэтому просто логика. Видимо ваша вероятность снижается из-за того, что маска «поймает» часть, как вы говорите «брызг слюней и соплей». (На большее она не способна.)
Особенно обратите внимание на слово «часть».
Брызг значит вы боитесь…
Я уже писал об устройстве которое на 100% защит от «брызг и соплей». Называется «щиток заточника».
Придется повторить. Вот. Со справедливыми комментариями уважаемого доктора. На минуточку, практика.
l-s писал(а):
VIST57 писал(а):
egoMANIAC писал(а):
Сейчас, когда обязательный масочный режим ввели всё более - менее нормально. Но тоже недалёких хватает. Буду от них защитные барьеры возводить

Вот такая штука должна помогать лучше, чем тряпочка.
Изображение
Во всяком случае от брызг защитит на 100%. Причем в обе стороны.
Да что там от брызг. Ребята в цеху рассказывали,что даже от запаха алкоголя, при разговоре с начальством, защищает лучше любой жвачки, если башкой не вертеть. У них она называлась «конусоотсекатель». :D
PS
Раньше эта штука называлась «щиток заточника», а теперь «щиток токаря»…
Видимо для увеличения продаж. (токарей больше)
Хотя токарю она, «как собаке пятая нога».

Активно используется многими в красной зоне. Защита практически никакая - нет барьеров в потоке вдыхаемого и вдыхаемого воздуха.

И особенно обратите внимание на мой ответ.
VIST57 писал(а):
l-s писал(а):
Активно используется многими в красной зоне. Защита практически никакая - нет барьеров в потоке вдыхаемого и вдыхаемого воздуха.

Согласен. Конечно нет барьеров. Но здесь люди стараются защититься от брызг, собственно только от этого и способна защитить маска, а по настоящему защищаться надо от мелких аэрозолей. (брызги все равно не попадают глубоко в носоглотку, откуда берут мазок и видимо где находятся «ворота проникновения вируса»)
А для этих аэрозолей маска не преграда. Это легко проверить. Достаточно подышать через маску на стекло — оно запотеет. Да и щелей там достаточно. У переносицы, у ушей...

Еще несколько слов о респираторах.
Если на респираторе написано, что он защищает от аэрозолей, то это совсем про другие аэрозоли. Это про туман от краскопульта. (если вы знаете о чем это я)
И тем не менее в «малярке» основная защита это хорошая вентиляция. Еще водяная защита.
А от тех, более мелких аэрозолей, которые выделяются при выдохе и разговоре, он не защищает. Поэтому, когда была настоящая эпидемия гонконгского гриппа маски носили те кому положено, хирурги, например. И то не всегда, а только когда необходимо. Кстати, стоматологи в то время работали без масок…
Но правильные рекомендации были. Чаще проветривать помещения и делать влажную уборку. (аналог вентиляции и водяной защиты в «малярке») Это резко снижает концентрацию вируса в воздухе. (Врачи почему-то концентрацию называют вирусной нагрузкой)
Я всегда одеваю маску, где просят. Это проще. Бессмысленно дискутировать с безграмотными верующими, или запуганным штрафами персоналом.
Но одевая маску, я трезво отдаю себе отчет в том, что она не спасает ни меня, ни окружающих. С таким же успехом можно и крестик одеть. Приходится терпеть неудобства. Очки потеют...
Поэтому отношусь к этому спокойно. Но повторять глупость о ношении этих тряпочек не буду. Кстати весной этого не было. Наоборот объясняли, что маска бесполезна. Но видимо по мере строительства заводов по производству масок, польза их стала расти.
Тогда другая глупость пропагандировалась. Скверы и парки закрыли. Видимо там вирусы скрывались. А еще во многих станах с вирусом борются при помощи комендантского часа.
Это за каких баранов надо считать людей.
PS
Насчет вреда масок. Вот такая проблема нарисовалась. Так себе проблема… Но оказывается есть.
Маскне: Какой вред коже наносят маски и как с ним бороться?
Воистину. Заставь Богу молиться…

принципы науки суть временные условные соглашения, приспособленные к опыту, но не имеющие прямых аналогов в реальности.
Анри́ Пуанкаре́.

Те, кто верует слепо, пути не найдут,
Тех, кто мыслит, - сомнения вечно гнетут.
Омар Хайям.


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 1:06
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
******
Аватара пользователя

Зарегистрирован: 20 ноя, 2007, 11:39
Сообщения: 2239
Откуда: Москва
Баллов: 304

Добавить баллУбрать балл
Маски - это полбеды. Опасность коронавируса, что максимум выделения в самом начале симптомов - коэффициент распространения выше, чем у гриппа. Антитела пропадают через 4-6 месяцев, второй раз болеют тяжелее, у некоторых остается длительно, т.е. если вакцина не сработает, то большинство умрет от ковида и его последствий (инсультов, инфарктов и т.д.). В реальности это будет означать введение чрезвычайного положения, жесткого карантина, ответных бунтов и другую жесть.
А очень многие не хотят вакцинироваться....

"Непобедимость заключена в самом себе, возможность победы заключена в противнике"


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 1:35
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
*******
Аватара пользователя

Зарегистрирован: 14 янв, 2015, 15:38
Сообщения: 3461
Баллов: 1170

Добавить баллУбрать балл
cut писал(а):
Maikle писал(а):
Исследования японцев про пользу масок
https://www.scmp.com/news/asia/east-asia/article/3106630/face-masks-block-90-cent-coronavirus-cant-stop-transmission

https://www.youtube.com/watch?v=He6jyfcDNRo&feature=youtu.be
Цитата:
В Токийском университете проверили эффективность рекомендации ВОЗ по ношению масок. С японской дотошностью они заправили "кашляющий" манекен слюной с вирусом и подобрали заданное соотношение размера капелек.

"Вдыхающий" манекен подключили к аппарату ИВЛ и с помощью ПЦР с обратной транскрипцией в реальном времени контролировали количество "вдыхаемых" вирусных РНК.
Результаты:
1. Маски действительно снижают передачу РНК вируса от человека к человеку.
2. Эффективнее маска на "кашляющем", чем на "вдыхающем". Еще эффективнее на обоих.
3. Каждый эксперимент продолжался 20 минут. Варианты "на подбородке" и "три дня одну маску" не тестировались.
4. Ни одна маска не защищает на 100%. Даже респиратор, приклеенный скотчем.
5. Процент переданной РНК не равен вероятности заражения. Иммунитет тоже имеет значение.
Эксперименты в таблице проводились на расстоянии полметра. При уменьшении расстояния вдвое количество переданной РНК увеличивалось в два с половиной раза.
При увеличении расстояния вдвое количество РНК снижалось в полтора раза. То есть, в набитом и полупустом транспорте разница будет почти в четыре раза. Там же и без масок - ещё в четыре

Изображение

я апну еще раз. иценков, канешь, опять не поймет, но остальным интересно будет.

Прежде, чем «апать», можно разобраться? Как можно вестись на эту «лапшу»?
За год можно «въехать в тему»?
Вот ссылка на само исследование:
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7580955/
Что вы прицепились к этой лаже? Вас думать в детстве не научили?
После этого...
cut писал(а):
и с помощью ПЦР с обратной транскрипцией в реальном времени контролировали количество "вдыхаемых" вирусных РНК.

сразу можно «сливать воду». Почему вы ссылаетесь, в частности на ПЦР, не понимая,что это такое? Пора бы давно уже «въехать в тему», прочитать что такое это ПЦР, разобраться… Слава Богу уже полгода прошло. И все никак. Может быть тогда поймете чего стоят эти тесты.
Да хоть эту «педи-вики» если на большее не способны. Там очень доступно написано, правда для тех, кто нормальную советскую школу заканчивал.
А читать, учиться это не царское дело? Ах да. Для этого надо быть специалистом со справкой. А вам остается Ctr+C, Ctr+V. Это удобно. Мозги напрягать не надо.
Прав профессор Савельев, что есть люди, которые пользуются мозгом несколько раз в жизни. К моему удивлению, они не просто есть, их стало очень много.
Теперь по сути…
1. ПЦР тестов не бывает. Есть ПЦР реакция. Для этой реакции надо время. (30-40 циклов имения температурного режима) поэтому никаких «ПЦР с обратной транскрипцией в реальном времени» быть не может.
2. Тесты с применением ПЦР реакции не дают численных результатов. Только есть или нет в образце заранее искомые последовательности нуклеотидов. Откуда берутся проценты?
3. Где они взяли эти РНК? Если до сих пор «изолянта» вируса не существует? И это не секрет.
4. Каким образом они обеспечивали концентрацию вируса (штук/миллилитр)? Почему всем понятная концентрация называется «вирусной нагрузкой»?
Ну и «до кучи»…
Почему эти манекены для демонстрации головных уборов, стоят в аквариуме меньше одного кубометра? Без аквариума совсем «не выходит каменный цветок»?
Почему манекены понятно. Это работа на публику. Этими манекенами декорирована алюминиевая труба и никакого намека хотя бы на модель носоглотки.
PS
Немного про «заранее искомые последовательности нуклеотидов»…
В данной пародии на исследования искали три последовательности длиной в 20 нуклеотидов каждая.
AAATTTTGGGGACCAGGAAC
TGGCACCTGTGTAGGTCAAC
ATGTCGCGCATTGGCATGGA

и на основании этого, как бы утверждается, что там присутствует вся искомая РНК. (целиком, не кусками, не в разных РНК, а именно в одной)
Для справки. Считается, что длина РНК «ковида» 30 000 нуклеотидов.
А теперь сами для себя решите, можно ли однозначно определить последовательность долиной в 30000 элементов по трем случайно взятым кускам длиной в 20 элементов?
Для простоты - пример из жизни. (вы когда-нибудь сдавали «тысячи» при изучении например английского?)
Так вот. Одна журнальная страница (без илюстраций) содержит примерно 2000 знаков.
30 000 — это 15 страниц только не такого текста к которому мы привыкли, а совершенно бессмысленного текста без пробелов состоящего всего из 4 букв (A, T, G и С).
Вот и опознайте все 15 страниц по трем кусочкам длиной в 20 символов.
Это ТАК. Чего стоит великий и ужасный ПЦР… Кстати сам автор этой реакции, нобелевский лауреат, (фамилию не помню, искать не хочу) не рекомендовал использовать ее в диагностике.

принципы науки суть временные условные соглашения, приспособленные к опыту, но не имеющие прямых аналогов в реальности.
Анри́ Пуанкаре́.

Те, кто верует слепо, пути не найдут,
Тех, кто мыслит, - сомнения вечно гнетут.
Омар Хайям.


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 3:20
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
******
Аватара пользователя

Зарегистрирован: 20 ноя, 2007, 11:39
Сообщения: 2239
Откуда: Москва
Баллов: 304

Добавить баллУбрать балл
VIST57 писал(а):
Что вы прицепились к этой лаже? Вас думать в детстве не научили?

1. Вирус уже давно выделен и сотни лабораторий расшифровали его геном.
Вот здесь можно посмотреть результаты расшифровок по датам.
https://www.ncbi.nlm.nih.gov/labs/virus/vssi/#/virus?SeqType_s=Nucleotide&VirusLineage_ss=SARS-CoV-2,%20taxid:2697049
Иценкова про "изоляты" не слушайте - человек бредит.
2. ПЦР в реальном времени - стандартная и давно отработанная методика.
3. В исследовании использовали реальный живой коронавирус - он распылялся через один манекен, а в другом манекене было встроено улавливающее устройство.

Датское и американское исследование по маскам - это просто опросы людей, которые склонны врать по своей натуре.
Это исследование ин витро - наиболее объективно.

"Непобедимость заключена в самом себе, возможность победы заключена в противнике"


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 3:33
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
online
******

Зарегистрирован: 21 июл, 2014, 13:50
Сообщения: 2754
Баллов: 215

Добавить баллУбрать балл
VIST57 писал(а):
Приходилось. Всяко-разно… Я ведь не просто конструктор, а еще через тире — технолог.
Поэтому литейка, молярка, гальваника, кузня… И отлично знаю чем там надо защищаться.
С маской вас там на смех подняли бы. Хотя там и пыль и аэрозоли покрупнее будут, на несколько порядков.
Но прогресс уже есть. Значит сопротивление, говорите. Хорошо.
Тогда заканчивайте нести дичь про то, что надо носить маску исключительно, чтобы защитить окружающих.



Так и вы, смотрю, эволиционируете тоже. Где я писал про "исключительно"? Я писал "в обе строны".А вы сравнивали как оно - прогуляться по пыльному цеху хотя бы в маске или без маски вообще? Лучше, конечно бы космический скафандр с изолированным дыхательным циклом или хотя бы ОЗК+ противогаз. Но за невозможностью приходится применять самое простое и доступное средство.


Последний раз редактировалось из Калининграда 23 ноя, 2020, 4:12, всего редактировалось 1 раз.

 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 3:59
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
online
******

Зарегистрирован: 21 июл, 2014, 13:50
Сообщения: 2754
Баллов: 215

Добавить баллУбрать балл
Sudak писал(а):
Экий Вы непосредственный. :)
Но, поддерживаю.

Возможно, эмоциональная реакция переболевших на источник их болезни. Я вот тоже заснуть не могу. Завтра(точне уже сегодня) месяц больничного. Боли в спине по длинным мышцам при попытке повернуться в кровати(раньше были ещё и в животе). Попытка встать с постели напоминает погрузку танка на платформу или установку опоры ЛЭП в вертикальное положение. Причём усиливаются именно при засыпании. Забудешься, дёрнешься, скрючит, проснёшься - первая мысль действительно перетянуть дрыном берёзовым того, кто это придумал, поперёк хари.
Насчёт эффективности масок - я работал с большим потоком людей, но у нас строго - маски, контроль температуры на входе. До меня заболела жена(уже выписали). Накануне у неё на работе сотрудницу увезли с пневмонией, госпитализировали с большим скандалом. Масок у них в конторе, разумеется, никто не носил. Два случая конечно не выборка- но всё же.


Последний раз редактировалось из Калининграда 23 ноя, 2020, 4:14, всего редактировалось 2 раз(а).

 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 4:01
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
online
******

Зарегистрирован: 21 июл, 2014, 13:50
Сообщения: 2754
Баллов: 215

Добавить баллУбрать балл
Maikle писал(а):
второй раз болеют тяжелее,

Есть статистика?Интересно, почему.


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 4:06
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
online
******

Зарегистрирован: 21 июл, 2014, 13:50
Сообщения: 2754
Баллов: 215

Добавить баллУбрать балл
VIST57 писал(а):
Насчет вреда масок. Вот такая проблема нарисовалась. Так себе проблема…

А я слышал, что при ношении бронежилета под ним тоже кожа преет и потёртости бывают. Да и защита от него так себе...


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 6:11
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
12k сообщений+
Аватара пользователя

Зарегистрирован: 04 май, 2008, 10:28
Сообщения: 12173
Откуда: Россия, Электросталь
Warnings: 1
Баллов: 2566

Добавить баллУбрать балл
из Калининграда писал(а):
VIST57 писал(а):
Насчет вреда масок. Вот такая проблема нарисовалась. Так себе проблема…

А я слышал, что при ношении бронежилета под ним тоже кожа преет и потёртости бывают. Да и защита от него так себе...

Добавлю про бронежилеты: нифига не защищают от пуль в башку и ноги. Бесполезны абсолютно!
Надевают их только дураки.

Я уже не говорю о взрывозащитных костюмах или оборудовании пожарных. Шлак и туфта полная!
И ваще - акваланги - тоже хрень. Не нужны. Кто говорит, что без них никак - дураки.

Изображение Изображение
Коронавирус показал, кто у нас на самом деле болен


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 8:21
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
покоритель восьмитысячников +

Зарегистрирован: 10 мар, 2005, 19:26
Сообщения: 9339
Откуда: Севастополь, Россия
Баллов: 845

Добавить баллУбрать балл
Ledand писал(а):
Кто Вас принуждает?


А штрафы?

www.gerdariki.ucoz.ru


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 8:25
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
покоритель восьмитысячников +

Зарегистрирован: 10 мар, 2005, 19:26
Сообщения: 9339
Откуда: Севастополь, Россия
Баллов: 845

Добавить баллУбрать балл
Maikle писал(а):
Вирус уже давно выделен и сотни лабораторий расшифровали его геном.


Тот, что расшифровали - не опасен и не ковид 19. Ссылку на документы дайте. Вы верите манекенам, а мы - докторам наук. Разница видите? И, опять же о ваших манекенах. Что за научная работа, кто автор?

www.gerdariki.ucoz.ru


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 8:31
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
покоритель восьмитысячников +

Зарегистрирован: 10 мар, 2005, 19:26
Сообщения: 9339
Откуда: Севастополь, Россия
Баллов: 845

Добавить баллУбрать балл
из Калининграда писал(а):
А я слышал, что при ношении бронежилета под ним тоже кожа преет и потёртости бывают. Да и защита от него так себе...


Кстати, да. Спорная защита от бронежелета. В нем человек становится неповоротливым. В Афгане мало кто им пользовался. По крайней мере, подвижность без броника увеличивалась в разы и спасала как раз за счет быстроты действий. Хотя я не скажу, что броник бесполезен. Вы опять сравниваете не сравниваемое. Смешиваете понятия, манипулируете.

www.gerdariki.ucoz.ru


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 8:34
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
покоритель восьмитысячников +

Зарегистрирован: 10 мар, 2005, 19:26
Сообщения: 9339
Откуда: Севастополь, Россия
Баллов: 845

Добавить баллУбрать балл
Perf писал(а):
Я уже не говорю о взрывозащитных костюмах или оборудовании пожарных. Шлак и туфта полная!
И ваще - акваланги - тоже хрень. Не нужны. Кто говорит, что без них никак - дураки.


Вы - негодяй. Почему же вы, коль акваланги дают такую пользу, ходите без них? Что?! Чего мычите? Ааа. Вы ходите без акваланга и вас за это не штрафуют? Так какого черта сравниваете то, что сравнивать негоже?

www.gerdariki.ucoz.ru


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 8:44
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
оби ван кеноби
Аватара пользователя

Зарегистрирован: 22 мар, 2014, 19:14
Сообщения: 5098
Откуда: Ленинград
Баллов: 1366

Добавить баллУбрать балл
Иценков писал(а):
из Калининграда писал(а):
А я слышал, что при ношении бронежилета под ним тоже кожа преет и потёртости бывают. Да и защита от него так себе...


Кстати, да. Спорная защита от бронежелета. В нем человек становится неповоротливым. В Афгане мало кто им пользовался. По крайней мере, подвижность без броника увеличивалась в разы и спасала как раз за счет быстроты действий. Хотя я не скажу, что броник бесполезен. Вы опять сравниваете не сравниваемое. Смешиваете понятия, манипулируете.

Докажите, что он сравнивает несравнимаемое. В каких документах написано, что с бронежилетом сравнивать нельзя? Почему нельзя?

См. под спойлером.)))
 

Реподрочат друг другу и форумчанам дружной стаей). И минусами, и плюсами. См. в репы.)
501, SOFAD, Parvus - клоны? Нарушение правил форума?


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 9:02
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
покоритель восьмитысячников +

Зарегистрирован: 10 мар, 2005, 19:26
Сообщения: 9339
Откуда: Севастополь, Россия
Баллов: 845

Добавить баллУбрать балл
Апелляционный суд Португалии считает тесты ПЦР ненадежными и отменяет карантин. Насколько информация достоверна, не берусь судить. Но, интернет сообщает вот что: Апелляционный Суд Португалии признал ПЦР-тестирование фейком, а карантин незаконным

Это просто бомба! Суд Португалии признал ПЦР-тестирование фейком, а карантин незаконным!


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 9:05
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
покоритель восьмитысячников +

Зарегистрирован: 10 мар, 2005, 19:26
Сообщения: 9339
Откуда: Севастополь, Россия
Баллов: 845

Добавить баллУбрать балл
Ирина спб писал(а):
Докажите, что он сравнивает несравнимаемое. В каких документах написано, что с бронежилетом сравнивать нельзя? Почему нельзя?


Вы что, каждый день ходите в бронежелете? Вас отказываются обслуживать, если у вас отсутствует бронежелет? Вас кто-то штрафует, если у вас нет бронежелета?

www.gerdariki.ucoz.ru


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 9:12
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
*****
Аватара пользователя

Зарегистрирован: 03 июл, 2008, 14:36
Сообщения: 1657
Откуда: Горы слева, горы справа, посредине ...
Баллов: 679

Добавить баллУбрать балл
В поиске пабмед вводим ключевые слова mask protection covid, 800 результатов за этот год страница поиска с результатами Читаем, изучаем, если есть желание. Обсуждаются не только сравнительные преимущества масочного режима, но и зависимость от полученной дозы вируса на тяжесть течения болезни, например:
Цитата:
Есть две вероятные причины эффективности масок для лица: первая - предотвращение распространения вирусных частиц от бессимптомных людей к другим - привлекла большое внимание. 10 , 11 Однако вторая теория о том, что уменьшение инокулята вируса, которому подвергается носитель маски, приведет к более легкому заболеванию 12 - 27, получила меньше внимания и является фокусом нашей точки зрения, объединяющей вирусологические, эпидемиологические и экологические доказательства. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7393808/


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 9:26
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
12k сообщений+

Зарегистрирован: 08 мар, 2017, 20:36
Сообщения: 16045
Баллов: 2367

Добавить баллУбрать балл
Lika_34
Соболезную в связи с уходом папы.
Здоровья вам и вашим близким.
Шиповник, кедровые орехи...

Иногда мне мечтается, что переболевшие форумчане прикрепят к аватарке (или как оно называется - то, что слева) или в подписи значок, показывающий уже состоявшееся знакомство с ковидой. Или два значка: переболевший и контактный.
Тогда и посты форумчан со значком обретут свой оттенок для всех читающих и - отдельно - для их оспаривающих ковид-диссидентов разной степени активности.
Читаю диссидентов и вспоминаю народное "Чужую беду руками разведу". Никому не желаю заболеть. Но рекомендовала бы не болевшим, не потерявшим близких от ковида чуток поубивать пыла. Не дай бог накличете.

Изображение


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 9:33
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
online
кирилл и мефодий

Зарегистрирован: 29 янв, 2014, 14:16
Сообщения: 7895
Баллов: 568

Добавить баллУбрать балл
Иценков

Они там вообще все тесты и анализы обьявили не имеющими юридической силы, не только на коронавирус

Региональное управление здравоохранения Азорских островов не является задачей объявить кого-то больным или опасным для здоровья. Только врач может это сделать. Никто не может быть объявлен больным или опасным для здоровья указом или законом, даже как автоматическое, административное следствие результата лабораторного теста, независимо от того, какого рода.

Из этого суд делает вывод, что „при осуществлении без предварительного врачебного наблюдения за пациентом без участия одного через Ordem dos Médicos сертифицированных врача, симптомы оценивались необходимыми для испытаний/испытания потребовали бы, чтобы каждое действие диагноз, или какие-либо действия по Мониторингу общественного здоровья (например, установление наличия вирусной инфекции или высокий риск Облучения, что вышеуказанные термины суммируют) против [ряд законов и нормативных актов] и нарушает преступление usurpação de funções [незаконное осуществление профессиональной] может представлять, если эти действия выполняются или кем-то продиктовано, способности для этого не хватает, то есть кто-то, не approbierter врача [чтобы практиковать в Португалии медицины, не достаточно просто иметь диплом , Человек muss может быть признан квалифицированным для осуществления профессии врача, пройдя экзамен с Ordem DOS médicos]“.

Кроме того, суд отмечает, что агентство здравоохранения Азорских островов нарушило статью 6 Всеобщей декларации о биоэтике и правах человека, поскольку не смог предоставить доказательства того, что информированное согласие, предписанное в этой декларации, было предоставлено лицами, проверенными ПЦР, которые жаловались на меры принудительного карантина, налагаемые на них.

Из фактов, представленных суду, он заключил, что ни до, ни после проведения теста не было доказательств или даже доказательств того, что четыре человека, о которых идет речь, были обследованы врачом.


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 9:45
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
online
кирилл и мефодий

Зарегистрирован: 29 янв, 2014, 14:16
Сообщения: 7895
Баллов: 568

Добавить баллУбрать балл
То есть суд принял решение, что ни кто не может поместить человека на карантин без заключения врача, по каждому конкретному случаю. По моему ничего хорошего в этом нет. Китай вон в целых городах карантин вводит, получается, с точки зрения португальского суда это незаконно.


 
 Профиль Отправить email  
 
СообщениеДобавлено: 23 ноя, 2020, 9:50
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
12k сообщений+

Зарегистрирован: 08 мар, 2017, 20:36
Сообщения: 16045
Баллов: 2367

Добавить баллУбрать балл
Сначала меня осмотрел врач, вызванный на дом, на следующий день пришли и взяли мазок. Оказался положительным. И что, надо было еще раз приходить врачу и меня осматривать ради узаканивания диагноза? Или мне, полудохлой, тащиться в поликлинику с риском для окружающих? ИМХО, дурь. Тем более при нынешней загруженности медработников.

Изображение


 
 Профиль  
 
СообщениеДобавлено: 23 ноя, 2020, 10:01
Заголовок сообщения: Re: Коронавирус.Сидите дома и не шарахайтесь!
offline
*******

Зарегистрирован: 22 авг, 2008, 21:51
Сообщения: 3181
Откуда: Воронеж, Россия
Баллов: 348

Добавить баллУбрать балл
из Калининграда писал(а):
Maikle писал(а):
второй раз болеют тяжелее,

Есть статистика?Интересно, почему.

статистики похоже еще нет, но и у нас и за бугром периодически проскакивает - повторно заболевшие зачастую болеют гораздо тяжелее.
утешает одно - повторные случаи не массовые, скорее относительно единичные.
ну и последнее по этой теме - _вроде_ как клетки памяти сохраняются гораздо дольше и срабатывают даже при отсутствии антител. но пока это тоже достоверно не подтверждено.

вот. нашел:
Цитата:
22 ноября 2020 TVE Оригинал
TVE: новое исследование учёных из США внушает надежду на многолетний иммунитет от коронавируса
Материал представлен в переводе ИноТВ
https://ru.rt.com/Iq0hz
Учёные из Института иммунологии Ла-Хойи в Калифорнии выяснили, что у людей через пять месяцев после перенесённого коронавируса сохранились 3 из 4 компонентов иммунологической памяти, передаёт TVE. Хотя эти данные, как отмечает испанский канал, ещё подлежат проверке, однако это исследование внушает оптимизм и надежду на длительный иммунитет от COVID-19.
Сейчас один из главных вопросов: сколько длится иммунитет от коронавируса? Группа авторитетных американских исследователей приблизилась к ответу на него.

После перенесённого вируса у организма появляется серьёзная иммунная реакция на него, сообщил в Twitter один из авторов из Института иммунологии Ла-Хойи в Калифорнии.

Исследование охватило 185 человек в возрасте от 19 до 81 года. У этих людей через пять месяцев после перенесённого вируса сохранились три из четырёх компонентов так называемой иммунологической памяти.

МАРКО ЛОПЕС, президент Испанского общества иммунологии: Логично, что она сохраняется дольше. Мы опираемся на предыдущие исследования, например, по SARS-CoV-1. Там Т-клетки сохранились у людей через 17 лет после болезни.

Эти клетки помогают производить дополнительное количество антител в том случае, если они со временем исчезнут. Среди участников исследования иммунный ответ не был одинаковым.

МАРКО ЛОПЕС: Есть целый перечень факторов, которые, очевидно, влияют на качество иммунного ответа: возраст, пол, вирусная нагрузка, предрасположенность к различным заболеваниям.

Это исследование ещё подлежит проверке, но уже внушает оптимизм. Эти результаты наводят на мысль о том, что эффект от вакцины может длиться больше одного сезона.


 
 Профиль  
 
Показать сообщения за:  Поле сортировки  
Начать новую тему Ответить на тему  [ Сообщений: 34150 ]  На страницу Пред.  1 ... 1352, 1353, 1354, 1355, 1356, 1357, 1358 ... 1366  След.

Часовой пояс: UTC + 3 часа

Вы не можете начинать темы
Вы не можете отвечать на сообщения
Вы не можете редактировать свои сообщения
Вы не можете удалять свои сообщения


Сейчас этот форум просматривают: Krugomer, MarinkaMari, O.S.O, princessssa, Stepan Stepanich, из Калининграда и гости: 34

Перейти:  
Правила севастопольского политического форума

 

 



Powered by phpBB © 2000-2011 phpBB Group
Русская поддержка phpBB